TRADD cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

TRADD cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
939 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human TNFRSF1A-associated via death domain with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.98kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TRADD cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRADD cDNA ORF Clone, Human, C-HA tag: Validated Images

TRADD cDNA ORF Clone, Human, C-HA tag: Synonyms

Hs.89862 cDNA ORF Clone, Human

TRADD Background Information

Full Name
TNFRSF1A-associated via death domain
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • TNF Signaling
    TNF Signaling
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
  • IL17 signaling pathway
    IL17 signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.