ROCK1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

ROCK1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4065 bp
Description
Full length Clone DNA of Human Rho-associated, coiled-coil containing protein kinase 1
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ROCK1 cDNA ORF Clone, Human, untagged: Synonyms

P160ROCK cDNA ORF Clone, Human; ROCK-I cDNA ORF Clone, Human

ROCK1 Background Information

Rac1, Pak1 and Rock1 are indicators related to gastric cancer invasion and metastasis, but few reports discuss all three kinds of protein in research on gastric cancer invasion and metastasis. Rac1, Pak1 and Rock1 may be important biomarkers of gastric carcinoma invasion and metastasis.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.