RAB4A cDNA ORF Clone, Human, N-GFPSpark® tag

1/1
Price:
Size:
Number:

RAB4A cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1386 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human RAB4A, member RAS oncogene family.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.39kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RAB4A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB4A cDNA ORF Clone, Human, N-GFPSpark® tag: Validated Images

RAB4A cDNA ORF Clone, Human, N-GFPSpark® tag: Synonyms

HRES-1 cDNA ORF Clone, Human; HRES-1/RAB4 cDNA ORF Clone, Human; HRES1 cDNA ORF Clone, Human; RAB4 cDNA ORF Clone, Human

RAB4A Background Information

Full Name
RAB4A, member RAS oncogene family
Related Pathways
  • Autophagy Pathway
    Autophagy Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.