PSMA cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

PSMA cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2199 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 843T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human folate hydrolase (prostate-specific membrane antigen) 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.2kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

PSMA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMA cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

PSMA cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

FGCP cDNA ORF Clone, Human; FOLH cDNA ORF Clone, Human; GCP2 cDNA ORF Clone, Human; GCPII cDNA ORF Clone, Human; mGCP cDNA ORF Clone, Human; NAALAD1 cDNA ORF Clone, Human; NAALAdase cDNA ORF Clone, Human; PSM cDNA ORF Clone, Human; PSMA cDNA ORF Clone, Human

PSMA Background Information

Glutamate carboxypeptidase 2, also known as Glutamate carboxypeptidase II, Membrane glutamate carboxypeptidase, Prostate-specific membrane antigen, GCPII, PSMA, FOLH1, and NAALAD1, is a single-pass type II membrane protein which belongs to thepeptidase M28 family and M28B subfamily. FOLH1 is highly expressed in prostate epithelium. It is detected in urinary bladder, kidney, testis, ovary, fallopian tube, breast, adrenal gland, liver, esophagus, stomach, small intestine, colon, brain (at protein level), and the capillary endothelium of a variety of tumors. FOLH1 has both folate hydrolase and N-acetylated alpha linked acidic dipeptidase (NAALADase) activity. It has a preference for tri-alpha-glutamate peptides. Genetic variation in FOLH1 may be associated with low folate levels and consequent hyperhomocysteinemia. This condition can result in increased risk of cardiovascular disease, neural tube defects, and cognitive deficits. FOLH1 also shows a promising role in directed imaging and therapy of recurrent or metastatic disease.
Full Name
folate hydrolase (prostate-specific membrane antigen) 1
References
  • Israeli R.S., et al.,(1993), Molecular cloning of a complementary DNA encoding a prostate-specific membrane antigen. Cancer Res. 53:227-230.
  • Su S.L., et al., (1995), Alternatively spliced variants of prostate-specific membrane antigen RNA: ratio of expression as a potential measurement of progression.Cancer Res. 55:1441-1443.
  • O'Keefe D.S., et al.,(1998), Mapping, genomic organization and promoter analysis of the human prostate-specific membrane antigen gene.Biochim. Biophys. Acta 1443:113-127.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.