PFN1/Profilin 1 cDNA ORF Clone, Human, N-GFPSpark® tag

1/1
Price:
Size:
Number:

PFN1/Profilin 1 cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1152 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human profilin 1 with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.15kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PFN1/Profilin 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFN1/Profilin 1 cDNA ORF Clone, Human, N-GFPSpark® tag: Validated Images

PFN1/Profilin 1 cDNA ORF Clone, Human, N-GFPSpark® tag: Synonyms

ALS18 cDNA ORF Clone, Human

PFN1/Profilin 1 Background Information

Mutations in the profilin 1 (PFN1) gene cause amyotrophic lateral sclerosis (ALS), a neurodegenerative disease caused by the loss of motor neurons leading to paralysis and eventually death. PFN1 is a small actin-binding protein that promotes formin-based actin polymerization and regulates numerous cellular functions.
Full Name
profilin 1
Related Pathways
  • Non-Canonical Wnt Pathway
    Non-Canonical Wnt Pathway
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.