PDHA1 cDNA ORF Clone, Human, C-OFPSpark® tag

1/1
Price:
Size:
Number:

PDHA1 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1860 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pyruvate dehydrogenase (lipoamide) alpha 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.86kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PDHA1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDHA1 cDNA ORF Clone, Human, C-OFPSpark® tag: Validated Images

PDHA1 cDNA ORF Clone, Human, C-OFPSpark® tag: Synonyms

PDHA cDNA ORF Clone, Human; PDHAD cDNA ORF Clone, Human; PDHCE1A cDNA ORF Clone, Human; PHE1A cDNA ORF Clone, Human

PDHA1 Background Information

PDHA1, also known as C54G1, is an alpha subunit of pyruvate dehydrogenase. Pyruvate dehydrogenase, together with dihydrolipoamide acetyltransferase and lipoamide dehydrogenase, composes the pyruvate dehydrogenase (PDH) complex. The PDH complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. PDHA1 plays a key role in the function of the PDH complex. Defects in PDHA1 can cause pyruvate dehydrogenase E1-alpha deficiency. Defects in PDHA1 also are the cause of X-linked Leigh syndrome (X-LS). X-LS is an early-onset progressive neurodegenerative disorder with a characteristic neuropathology consisting of focal, bilateral lesions in one or more areas of the central nervous system, including the brainstem, thalamus, basal ganglia, cerebellum, and spinal cord.
Full Name
pyruvate dehydrogenase (lipoamide) alpha 1
References
  • Quintana E. et al., 2010, Clin Genet. 77 (5): 474-82.
  • Ah Mew N. et al., 2011, Pediatr Neurol. 45 (1): 57-9.
  • Pinheiro A. et al., 2012, Gene. 506 (1): 173-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.