Olig2 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Olig2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
972 bp
Description
Full length Clone DNA of Human oligodendrocyte lineage transcription factor 2
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About Olig2

Entrez Gene ID

Olig2 cDNA ORF Clone, Human, untagged: Synonyms

BHLHB1 cDNA ORF Clone, Human; bHLHe19 cDNA ORF Clone, Human; OLIGO2 cDNA ORF Clone, Human; PRKCBP2 cDNA ORF Clone, Human; RACK17 cDNA ORF Clone, Human

Olig2 Background Information

Olig2, also known as Oligo2, is a basic helix-loop-helix transcription factor that is expressed in oligodendroglial tumors of the brain. Oligo2 is structurally similar to OLIG1. Both of them have non-overlapping developmental functions in patterning, neuron subtype specification, and the formation of oligodendrocytes. Olig2 is required for oligodendrocyte and motor neuron specification in the spinal cord, as well as for the development of somatic motor neurons in the hindbrain. Its over-expression inhibits neural progenitor proliferation through changes in potassium channel activity, thereby contributing to the reduced neuronal numbers and brain size in down syndrome. Olig2 may be a cause of a form of T-cell acute lymphoblastic leukemia.
Full Name
oligodendrocyte transcription factor 2
References
  • Wang J, et al., 2000, Proc Natl Acad Sci. 97(7): 3497-502.
  • Lu QR, et al., 2001, Proc Natl Acad Sci. 98(19): 10851-6.
  • Marie Y, et al., 2001, Lancet. 358(9278): 298-300.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.