MMP7 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

MMP7 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
843 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human matrix metallopeptidase 7 (matrilysin, uterine) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.84kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

MMP7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP7 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

MMP7 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

MMP-7 cDNA ORF Clone, Human; MPSL1 cDNA ORF Clone, Human; PUMP-1 cDNA ORF Clone, Human

MMP7 Background Information

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological and pathological processes such as morphogenesis, differentiation, angiogenesis, tissue remodeling, and tumor invasion. MMPs are synthesized as pro-enzymes and converted to the active form by extracellular proteinases. MMP7 also referred to as matrilysin, is the smallest member of the MMP family and differs from other MMP members in that it lacks the C-terminal hemopexin-like domain. MMP7 is produced primarily by mucosal epithelia and is capable of degrading various ECM proteins including proteoglycans, fibronectin, elastin, and casein. This enzyme serves essential functions in both innate defense and wound healing, and appears to be one of the most important MMPs in human colon cancers. It has been reported that MMP7 contributes to tumor malignancy probably by cleaving cell surface proteins such as Fas ligand, degradation of IgG, or inducing E-cadherin-mediated cell aggregation. Besides, matrilysin is also identified as a mediator of pulmonary fibrosis and a potential therapeutic target.
Full Name
matrix metallopeptidase 7
Research Areas
References
  • Muller D., et al.,(1988), The collagenase gene family in humans consists of at least four members. Biochem. J. 253:187-192.
  • Marti H.P., et al., (1992), Molecular characterization of a low-molecular-mass matrix metalloproteinase secreted by glomerular mesangial cells as PUMP-1.Biochem. J. 285:899-905.
  • Gaire M., et al.,(1994), Structure and expression of the human gene for the matrix metalloproteinase matrilysin.J. Biol. Chem. 269:2032-2040.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.