MMP7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

MMP7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
804 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens matrix metallopeptidase 7 (matrilysin, uterine).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

MMP7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

MMP-7 cDNA ORF Clone, Human; MPSL1 cDNA ORF Clone, Human; PUMP-1 cDNA ORF Clone, Human

MMP7 Background Information

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological and pathological processes such as morphogenesis, differentiation, angiogenesis, tissue remodeling, and tumor invasion. MMPs are synthesized as pro-enzymes and converted to the active form by extracellular proteinases. MMP7 also referred to as matrilysin, is the smallest member of the MMP family and differs from other MMP members in that it lacks the C-terminal hemopexin-like domain. MMP7 is produced primarily by mucosal epithelia and is capable of degrading various ECM proteins including proteoglycans, fibronectin, elastin, and casein. This enzyme serves essential functions in both innate defense and wound healing, and appears to be one of the most important MMPs in human colon cancers. It has been reported that MMP7 contributes to tumor malignancy probably by cleaving cell surface proteins such as Fas ligand, degradation of IgG, or inducing E-cadherin-mediated cell aggregation. Besides, matrilysin is also identified as a mediator of pulmonary fibrosis and a potential therapeutic target.
Full Name
matrix metallopeptidase 7
Research Areas
References
  • Muller D., et al.,(1988), The collagenase gene family in humans consists of at least four members. Biochem. J. 253:187-192.
  • Marti H.P., et al., (1992), Molecular characterization of a low-molecular-mass matrix metalloproteinase secreted by glomerular mesangial cells as PUMP-1.Biochem. J. 285:899-905.
  • Gaire M., et al.,(1994), Structure and expression of the human gene for the matrix metalloproteinase matrilysin.J. Biol. Chem. 269:2032-2040.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.