Midkine cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

Midkine cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
432 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human midkine (neurite growth-promoting factor 2), transcript variant 2.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 0.43kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Midkine cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Midkine cDNA ORF Clone, Human, untagged: Validated Images

Midkine cDNA ORF Clone, Human, untagged: Synonyms

ARAP cDNA ORF Clone, Human; MK cDNA ORF Clone, Human; NEGF2 cDNA ORF Clone, Human

Midkine Background Information

Midkine (MK or MDK) also known as neurite growth-promoting factor 2 (NEGF2) is a basic heparin-binding growth factor of low molecular weight, and forms a family with pleiotrophin. Midkine is a retinoic acid-responsive, heparin-binding growth factor expressed in various cell types during embryogenesis. It promotes angiogenesis, cell growth, and cell migration. Midkine is also expressed in several carcinomas, suggesting that it may play a role in tumorigenesis, perhaps through its effects on angiogenesis. Midkine binds anaplastic lymphoma kinase (ALK) which induces ALK activation and subsequent phosphorylation of the insulin receptor substrate (IRS1), followed by the activation of mitogen-activated protein kinase (MAPK) and PI3-kinase and the induction of cell proliferation. Midkine is involved in neointima formation after arterial injury, possibly by mediating leukocyte recruitment. Also involved in early fetal adrenal gland development. Midkine exhibited increased expression in the breast carcinomas but showed much lower expression in the normal breast tissue. Thus, it can be used as a breast carcinomas marker.
Full Name
midkine (neurite growth-promoting factor 2)
References
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Muramatsu H, et al. (1993) Midkine, a retinoic acid-inducible growth/differentiation factor: immunochemical evidence for the function and distribution. Dev Biol. 159(2): 392-402.
  • Muramatsu T. (2002) Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis. J Biochem. 132(3): 359-71.
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.