KDM5B cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

KDM5B cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4635 bp
Description
Full length Clone DNA of Human lysine (K)-specific demethylase 5B
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About KDM5B

Entrez Gene ID

KDM5B cDNA ORF Clone, Human, untagged: Synonyms

CT31 cDNA ORF Clone, Human; JARID1B cDNA ORF Clone, Human; PLU-1 cDNA ORF Clone, Human; PLU1 cDNA ORF Clone, Human; PUT1 cDNA ORF Clone, Human; RBBP2H1A cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.