JMJD6 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

JMJD6 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1212 bp
Description
Full length Clone DNA of Human jumonji domain containing 6 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

JMJD6 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Synonyms

PSR cDNA ORF Clone, Human; PTDSR cDNA ORF Clone, Human; PTDSR1 cDNA ORF Clone, Human

JMJD6 Background Information

JMJD6 (Jumonji Domain Containing 6, Arginine Demethylase And Lysine Hydroxylase) is a Protein Coding gene. This gene encodes a nuclear protein with a JmjC domain. JmjC domain-containing proteins are predicted to function as protein hydroxylases or histone demethylases. JMJD6 is a member of the Jumonji C family of Fe(II) and 2-oxoglutarate (2OG) dependent oxygenases. It possesses unique bi-functional oxygenase activities, acting as both an arginine demethylase and a lysyl-hydroxylase. JMJD6 has been reported to be over-expressed in oral, breast, lung, and colon cancers and plays important roles in the regulation of transcription through interactions with transcription regulator BRD4, histones, U2AF65, Luc7L3, and SRSF11. Diseases associated with JMJD6 include Myasthenic Syndrome, Congenital, 9, Associated With Acetylcholine Receptor Deficiency and Pancreatitis.
Full Name
jumonji domain containing 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.