ILT3 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

ILT3 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1347 bp
Description
Full length Clone DNA of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ILT3 cDNA ORF Clone, Human, N-HA tag: Synonyms

CD85K cDNA ORF Clone, Human; ILT-3 cDNA ORF Clone, Human; ILT3 cDNA ORF Clone, Human; LIR-5 cDNA ORF Clone, Human; LIR5 cDNA ORF Clone, Human

ILT3 Background Information

The leukocyte immunoglobulin-like receptor (LILR) B4 belongs to a family of cell surface receptors that possesses cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). LILRB4 is believed to down-regulate activation signals mediated by non-receptor tyrosine kinase cascades through the recruitment of SHP-1. LILRB4 is associated with the pathological processes of various inflammatory diseases.The LILRB4 is a central inhibitory receptor in uterine dendritic cells (uDCs) that plays essential immune-regulatory roles at the maternal-fetal interface.
Full Name
leukocyte immunoglobulin like receptor B4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.