ILKAP cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

ILKAP cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1179 bp
Description
Full length Clone DNA of Human integrin-linked kinase-associated serine/threonine phosphatase
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ILKAP cDNA ORF Clone, Human, untagged: Synonyms

ILKAP2 cDNA ORF Clone, Human; ILKAP3 cDNA ORF Clone, Human; PP2C-DELTA cDNA ORF Clone, Human

ILKAP Background Information

Integrin-linked kinase-associated serine/threonine phosphatase 2C, also known as ILKAP, is a cytoplasm protein that belongs to the PP2C family. ILKAP contains one PP2C-like domain. ILKAP is widely expressed. Highest levels expressed in striated muscle. Much lower levels are evident in various smooth muscle tissues. ILKAP may play a role in the regulation of cell cycle progression via dephosphorylation of its substrates whose appropriate phosphorylation states might be crucial for cell proliferation. ILKAP selectively associates with integrin-linked kinase (ILK), to modulate cell adhesion and growth factor signaling. ILKAP inhibits the ILK-GSK3B signaling axis and may play an important role in inhibiting oncogenic transformation. Integrin-linked kinase ( ILK ) plays key roles in a variety of cell functions, including cell proliferation, adhesion, and migration. Within the cell, ILK localizes to multiple sites, including the cytoplasm, focal adhesion complexes that mediate cell adhesion to extracellular substrates, as well as cell-cell junctions in epidermal keratinocytes. Nuclear ILK can be rapidly exported into the cytoplasm through a CRM1-dependent pathway, and its export is enhanced by the type 2C protein phosphatase ILKAP. Nuclear localization of ILK in epidermal keratinocytes is associated with increased DNA synthesis, which is sensitive to inhibition by ILKAP.
Full Name
integrin-linked kinase-associated serine/threonine phosphatase
Related Pathways
  • AKT Signaling Pathway
    AKT Signaling Pathway
References
  • Leung-Hagesteijn C. et al., 2001, EMBO J. 20: 2160-70.
  • Kumar,A.S. et al., 2004, Oncogene. 23 (19):3454-61.
  • Lammers,T. et al., 2007, Crit Rev Biochem Mol Biol. 42 (6):437-61.
  • Nakrieko,K.A. et al., 2008, Cell Cycle. 7 (14):2157-66.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.