IL17 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

IL17 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
468 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 17A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.51kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

IL17 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL17 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

IL17 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

CTLA-8 cDNA ORF Clone, Human; CTLA8 cDNA ORF Clone, Human; IL-17 cDNA ORF Clone, Human; IL-17A cDNA ORF Clone, Human; IL17 cDNA ORF Clone, Human

IL17 Background Information

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.
Full Name
interleukin 17A
Research Areas
Related Pathways
  • IL12 signaling pathway
    IL12 signaling pathway
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.

IL17 cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.