IL-29 cDNA ORF Clone, Human, C-Myc tag

1/1
Price:
Size:
Number:

IL-29 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
648 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interferon lambda 1
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.65kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-29 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About IL-29

Entrez Gene ID

IL-29 cDNA ORF Clone, Human, C-Myc tag: Validated Images

IL-29 cDNA ORF Clone, Human, C-Myc tag: Synonyms

IFNL1 cDNA ORF Clone, Human; IL-29 cDNA ORF Clone, Human; IL29 cDNA ORF Clone, Human

IL-29 Background Information

Interleukin-29 (IL-29), also known as cytokine Zcyto21, Interferon lambda-1, IFN-lambda-1, and IFNL1, is a secreted protein that belongs to the IL-28 / IL-29 family. IL-29 is a cytokine with immunomodulatory activity. IL-29 is highly similar in amino acid sequence to the IL-28. IL-28 and IL-29 are induced by a viral infection and showed antiviral activity. IL-28 and IL-29 interacted with a heterodimeric class II cytokine receptor that consisted of IL-10 receptor beta (IL-10Rbeta) and an orphan class II receptor chain, designated IL-28Ralpha. IL-29 plays an important role in host defenses against microbes and its gene is highly upregulated in cells infected with viruses. IL-29 may play a role in antiviral immunity. IL-29 up-regulates MHC class I antigen expression. It is a Ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IL28RA. The ligand/receptor complex seems to signal through the Jak-STAT pathway.
Full Name
interferon, lambda 1
References
  • Li MC, et al. (2006) Liposome-mediated IL-28 and IL-29 expression in A549 cells and anti-viral effect of IL-28 and IL-29 on WISH cells. Acta Pharmacol Sin. 27(4): 453-9.
  • Wang J, et al. (2009) Differentiated human alveolar type II cells secrete antiviral IL-29 (IFN-lambda 1) in response to influenza A infection. J Immunol. 182(3): 1296-304.
  • Jordan WJ, et al. (2007) Modulation of the human cytokine response by interferon lambda-1 (IFN-lambda1/IL-29). Genes Immun. 8(1): 13-20.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.