Hsp27/HSPB1 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

Hsp27/HSPB1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
618 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human heat shock 27kDa protein 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 0.62kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Hsp27/HSPB1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Hsp27/HSPB1 cDNA ORF Clone, Human, untagged: Validated Images

Hsp27/HSPB1 cDNA ORF Clone, Human, untagged: Synonyms

CMT2F cDNA ORF Clone, Human; HEL-S-102 cDNA ORF Clone, Human; HMN2B cDNA ORF Clone, Human; HS.76067 cDNA ORF Clone, Human; Hsp25 cDNA ORF Clone, Human; HSP27 cDNA ORF Clone, Human; HSP28 cDNA ORF Clone, Human; SRP27 cDNA ORF Clone, Human

Hsp27/HSPB1 Background Information

Full Name
heat shock 27kDa protein 1
Research Areas
Related Pathways
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.