GAPDH cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

GAPDH cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 381 T>C and 885 T>C not causing the amino acid variation.
Description
Full length Clone DNA of Human glyceraldehyde-3-phosphate dehydrogenase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI (6kb + 1.06kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

GAPDH cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GAPDH cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

GAPDH cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

G3PD cDNA ORF Clone, Human; GAPD cDNA ORF Clone, Human; HEL-S-162eP cDNA ORF Clone, Human

GAPDH Background Information

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.
Full Name
glyceraldehyde-3-phosphate dehydrogenase
Research Areas
References
  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.