Frizzled 10 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

Frizzled 10 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1791 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human frizzled family receptor 10 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.79kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Frizzled 10 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Frizzled 10 cDNA ORF Clone, Human, C-His tag: Validated Images

Frizzled 10 cDNA ORF Clone, Human, C-His tag: Alternative Names

CD350 cDNA ORF Clone, Human; FZ-10 cDNA ORF Clone, Human; Fz10 cDNA ORF Clone, Human; FzE7 cDNA ORF Clone, Human; hFz10 cDNA ORF Clone, Human

Frizzled 10 Background Information

Frizzled-1, also known as Fz-1, CD35 and FZD1, is a multi-pass membrane protein which belongs to theG-protein coupled receptor Fz/Smo family. Frizzled-1 / FZD1 is abundantly expressed in the cerebellum, followed by cerebral cortex, medulla and spinal cord; very low levels in total brain, frontal lobe, temporal lobe and putamen. It is weakly expressed in adult brain, heart, lung, skeletal muscle, pancreas, spleen and prostate. Frizzled-1 / FZD1 is a receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-1 / FZD1 may also be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues.
Full Name
frizzled class receptor 10
References
  • Kwon H.S., et al.,(2009), Myocilin is a modulator of Wnt signaling. Mol. Cell. Biol. 29:2139-2154.
  • The MGC Project Team, et al., (2004), The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC).Genome Res. 14:2121-2127.
  • Tanaka S., et al.,(1998), A novel frizzled gene identified in human esophageal carcinoma mediates APC/beta-catenin signals.Proc. Natl. Acad. Sci. U.S.A. 95:10164-10169.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.