FGFR3 cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

FGFR3 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2421 bp
Description
Full length Clone DNA of Human fibroblast growth factor receptor 3 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGFR3 cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

ACH cDNA ORF Clone, Human; CD333 cDNA ORF Clone, Human; CEK2 cDNA ORF Clone, Human; HSFGFR3EX cDNA ORF Clone, Human; JTK4 cDNA ORF Clone, Human

FGFR3 Background Information

FGFR3, also known as CD333, is a member of the fibroblast growth factor receptor (FGFR) family, with its amino acid sequence being highly conserved between members and among divergent species. FGFR family members differ from one another in their ligand affinities and tissue distribution. FGFRs are transmembrane catalytic receptors that have intracellular tyrosine kinase activity. Mutations in FGFR genes are the cause of several human developmental disorders characterized by skeletal abnormalities such as achondroplasia, and upregulation of FGFR expression may lead to cell transformation and cancer. FGFR3, a full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR3 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR3 binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in FGFR3 gene lead to craniosynostosis and multiple types of skeletal dysplasia. Three alternatively spliced transcript variants that encode different protein isoforms have been described. CD333 is the receptor for acidic and basic fibroblast growth factors.
Full Name
fibroblast growth factor receptor 3
References
  • Keegan K, et al. (1991) Isolation of an additional member of the fibroblast growth factor receptor family, FGFR-3. Proc Natl Acad Sci. 88(4):1095-9.
  • Hafner C, et al. (2007) FGFR3 mutations in epidermal nevi and seborrheic keratoses: lessons from urothelium and skin. J Invest Dermatol. 127(7):1572-3.
  • Lamy A, et al. (2006) Molecular profiling of bladder tumors based on the detection of FGFR3 and TP53 mutations. J Urol. 176(6 Pt 1):2686-9.
  • Schweitzer DN, et al. (2001) Subtle radiographic findings of achondroplasia in patients with Crouzon syndrome with acanthosis nigricans due to an Ala391Glu substitution in FGFR3. Am J Med Genet. 98 (1):75-91.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.