ERK5/BMK1/MAPK7 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

ERK5/BMK1/MAPK7 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2451 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase 7 (MAPK7), transcript variant 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ERK5/BMK1/MAPK7 cDNA ORF Clone, Human, N-His tag: Synonyms

BMK1 cDNA ORF Clone, Human; ERK4 cDNA ORF Clone, Human; ERK5 cDNA ORF Clone, Human; PRKM7 cDNA ORF Clone, Human

ERK5/BMK1/MAPK7 Background Information

Full Name
mitogen-activated protein kinase 7
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • Non-Canonical Wnt Pathway
    Non-Canonical Wnt Pathway
  • p53 Pathway
    p53 Pathway
  • TGF-beta Signaling
    TGF-beta Signaling
  • TNF Signaling
    TNF Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.