ERK5/BMK1/MAPK7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

ERK5/BMK1/MAPK7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2451 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 7 (MAPK7), transcript variant 3.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

ERK5/BMK1/MAPK7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

BMK1 cDNA ORF Clone, Human; ERK4 cDNA ORF Clone, Human; ERK5 cDNA ORF Clone, Human; PRKM7 cDNA ORF Clone, Human

ERK5/BMK1/MAPK7 Background Information

Full Name
mitogen-activated protein kinase 7
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • Non-Canonical Wnt Pathway
    Non-Canonical Wnt Pathway
  • p53 Pathway
    p53 Pathway
  • TGF-beta Signaling
    TGF-beta Signaling
  • TNF Signaling
    TNF Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.