ERK5/BMK1/MAPK7 cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

ERK5/BMK1/MAPK7 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3180 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mitogen-activated protein kinase 7 (MAPK7), transcript variant 3 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI(6kb+3.18kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ERK5/BMK1/MAPK7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ERK5/BMK1/MAPK7 cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

ERK5/BMK1/MAPK7 cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

BMK1 cDNA ORF Clone, Human; ERK4 cDNA ORF Clone, Human; ERK5 cDNA ORF Clone, Human; PRKM7 cDNA ORF Clone, Human

ERK5/BMK1/MAPK7 Background Information

Full Name
mitogen-activated protein kinase 7
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • Non-Canonical Wnt Pathway
    Non-Canonical Wnt Pathway
  • p53 Pathway
    p53 Pathway
  • TGF-beta Signaling
    TGF-beta Signaling
  • TNF Signaling
    TNF Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.