ERK1/MAPK3 cDNA ORF Clone, Human, C-GFPSpark® tag

1/2
Price:
Size:
Number:

ERK1/MAPK3 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6G>T and 9G>T not causing the amino acid variation.
Description
Full length Clone DNA of Human mitogen-activated protein kinase 3 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI (two restriction sites) + XbaI (6kb+1.25kb+0.63kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ERK1/MAPK3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ERK1/MAPK3 cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

ERK1/MAPK3 cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

ERK-1 cDNA ORF Clone, Human; ERK1 cDNA ORF Clone, Human; ERT2 cDNA ORF Clone, Human; HS44KDAP cDNA ORF Clone, Human; HUMKER1A cDNA ORF Clone, Human; p44-ERK1 cDNA ORF Clone, Human; p44-MAPK cDNA ORF Clone, Human; P44ERK1 cDNA ORF Clone, Human; P44MAPK cDNA ORF Clone, Human; PRKM3 cDNA ORF Clone, Human

ERK1/MAPK3 Background Information

MAPK3 (Mitogen-Activated Protein Kinase 3, also known as ERK1) is a Protein Coding gene. The protein encoded by the ERK1 gene is a member of the MAP kinase family. 3 alternatively spliced human isoforms have been reported. The protein is a serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK1/ERK2 and MAPK3/ERK1 are the 2 MAPKs that play an important role in the MAPK/ERK cascade. They participate also in a signaling cascade initiated by activated KIT and KITLG/SCF. ERK1 is widely expressed in the small intestine, colon, and other tissues. Diseases associated with MAPK3 include Neutrophil Migration and Pertussis.
Full Name
mitogen-activated protein kinase 3
Research Areas
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • TGF-beta Signaling
    TGF-beta Signaling
  • TNF Signaling
    TNF Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
  • IL1 signaling pathway
    IL1 signaling pathway
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Kolb RH, Greer PM, Cao PT, Cowan KH, Yan Y. ERK1/2 Signaling Plays an Important Role in Topoisomerase II Poison-Induced G2/M Checkpoint Activation. Tan M, ed. PLoS ONE. 2012;7(11):e50281.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.