EGFR cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

EGFR cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3633 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 2361 G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human epidermal growth factor receptor.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 3.63kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EGFR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EGFR cDNA ORF Clone, Human, untagged: Validated Images

EGFR cDNA ORF Clone, Human, untagged: Synonyms

ERBB cDNA ORF Clone, Human; ERBB1 cDNA ORF Clone, Human; HER1 cDNA ORF Clone, Human; mENA cDNA ORF Clone, Human; NISBD2 cDNA ORF Clone, Human; PIG61 cDNA ORF Clone, Human

EGFR Background Information

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.
Full Name
epidermal growth factor receptor
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
References
  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.
  • The dual-inhibitory effect of miR-338-5p on the multidrug resistance and cell growth of hepatocellular carcinoma
    Author
    Zhao, Y;Chen, J;Wei, W;Qi, X;Li, C;Ren, J;
    Year
    2018
    Journal
    Sig Transduct Target Ther
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.