EB3 cDNA ORF Clone, Human, C-GFPSpark® tag

1/2
Price:
Size:
Number:

EB3 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1575 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human microtubule-associated protein, RP/EB family, member 3 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.58kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EB3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EB3 cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

EB3 cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

EB3 cDNA ORF Clone, Human; EBF3 cDNA ORF Clone, Human; EBF3-S cDNA ORF Clone, Human; RP3 cDNA ORF Clone, Human

EB3 Background Information

MAPRE3 (Microtubule Associated Protein RP/EB Family Member 3, also known as EB3) is a Protein Coding gene. 2 alternatively spliced human isoforms have been reported. MAPRE3 is a member of the RP/EB family. It localizes to the cytoplasmic microtubule network and binds APCL. MAPRE3 regulates the dynamics of the microtubule cytoskeleton and promotes microtubule growth. It may be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes. MAPRE3 may also play a role in cell migration. MAPRE3 is broadly expressed in the brain, testis, and other tissues. Diseases associated with MAPRE3 include Neuronopathy, Distal Hereditary Motor, Type Viib, and Distal Hereditary Motor Neuronopathy Type 7.
Full Name
microtubule-associated protein, RP/EB family, member 3
References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Yeh TY. et al., 2005, J Cell Sci. 118 (15): 3431-43.
  • Mimori-Kiyosue Y. et al., 2005, J Cell Biol. 168 (1): 141-53.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.