Cyclin E cDNA ORF Clone, Human, C-GFPSpark® tag

1/2
Price:
Size:
Number:

Cyclin E cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1233 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cyclin E1 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.96kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cyclin E cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclin E cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

Cyclin E cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

CCNE cDNA ORF Clone, Human

Cyclin E Background Information

Cyclin E1 is a member of the highly conserved cyclin family and belongs to the E-type cyclin that functions as a regulator of S phase entry and progression in mammalian cells. Cyclin E1 serves as regulatory subunits that bind, activate, and provide substrate for its associated cyclin-dependent kinase2 (CDK2), whose activity is essential for cell cycle G1 / S transition. Over expression of this encoding gene has been found in many tumors, which results in chromosome instability and by extension, induce tumorigenesis. This protein was also found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. In general, cyclin E1, as an activator of phospho-CDK2 (pCDK2), is important for cell cycle progression and is frequently overexpressed in cancer cells.
Full Name
cyclin E1
Related Pathways
  • p53 Pathway
    p53 Pathway
References
  • Honda R, et al. (2005) The structure of cyclin E1 / CDK2: implications for CDK2 activation and CDK2-independent roles. The EMBO Journal. 24: 452-63.
  • Geng Y, et al. (2007) Kinase-Independent Function of Cyclin E. 25(1): 127-39.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.