CHOP/DDIT3 cDNA ORF Clone, Human, N-HA tag

1/1
Price:
Size:
Number:

CHOP/DDIT3 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
552 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human DNA-damage-inducible transcript 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI(6kb+0.55kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CHOP/DDIT3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHOP/DDIT3 cDNA ORF Clone, Human, N-HA tag: Validated Images

CHOP/DDIT3 cDNA ORF Clone, Human, N-HA tag: Synonyms

CEBPZ cDNA ORF Clone, Human; CHOP cDNA ORF Clone, Human; CHOP-10 cDNA ORF Clone, Human; CHOP10 cDNA ORF Clone, Human; GADD153 cDNA ORF Clone, Human

CHOP/DDIT3 Background Information

DDIT3, also known as GADD153 or CHOP, encodes a basic leucine zipper transcription factor of the dimer forming C/EBP family. DDIT3 is known as a key regulator of cellular stress response. DNA-damage-inducible transcript 3 (DDIT3), a candidate tumor suppressor gene (TSG), has been found involved in the regulation of cellular growth and differentiation. The aberrant methylation of DDIT3 occurs in CML frequently.
Full Name
DNA-damage-inducible transcript 3
Related Pathways
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.