CD18 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

CD18 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2310 bp
Description
Full length Clone DNA of Human integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD18 cDNA ORF Clone, Human, N-Myc tag: Synonyms

CD18 cDNA ORF Clone, Human; LAD cDNA ORF Clone, Human; LCAMB cDNA ORF Clone, Human; LFA-1 cDNA ORF Clone, Human; MAC-1 cDNA ORF Clone, Human; MF17 cDNA ORF Clone, Human; MFI7 cDNA ORF Clone, Human

CD18 Background Information

Integrins form a family of heterodimeric transmembrane receptors that regulate cell–adhesion and cell-extracellular matrix interactions. Lymphocyte function-associated antigen 1 (LFA-1, αLβ2) is a leukocyte specific integrin that mediates firm arrest of leukocytes on the endothelium during migration and establishes cell-cell contacts such as the immunological synapse between DCs and T cells. At the molecular level, transient modifications of adhesion are accomplished by conformational changes of LFA-1 from a bent down inactive to an upright active conformation with an open headpiece, leading to low- and high-affinity for its major ligand ICAM-1 respectively.
Full Name
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Autophagy Pathway
    Autophagy Pathway
References
  • Eich C, Lasonder E, Cruz LJ, et al. Proteome Based Construction of the Lymphocyte Function-Associated Antigen 1 (LFA-1) Interactome in Human Dendritic Cells. Mattei F, ed. PLoS ONE. 2016;11(2):e0149637.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.