CD160 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

CD160 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Human CD160 molecule with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

CD160 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Alternative Names

BY55 cDNA ORF Clone, Human; NK1 cDNA ORF Clone, Human; NK28 cDNA ORF Clone, Human

CD160 Background Information

CD16 antigen, also known as Natural killer cell receptor BY55 and CD16, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD16 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD16 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD16 is expressed in spleen, peripheral blood, and small intestine. Expression of CD16 is restricted to functional NK and T cytotoxic lymphocytes. CD16 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD16+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD16+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD16 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.
Full Name
CD160 molecule
References
  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.