CASP8/ALPS2B cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

CASP8/ALPS2B cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1440 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.48kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

CASP8/ALPS2B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CASP8/ALPS2B cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

CASP8/ALPS2B cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Synonyms

ALPS2B cDNA ORF Clone, Human; CAP4 cDNA ORF Clone, Human; Casp-8 cDNA ORF Clone, Human; FLICE cDNA ORF Clone, Human; MACH cDNA ORF Clone, Human; MCH5 cDNA ORF Clone, Human

CASP8/ALPS2B Background Information

Caspase 8 is a cysteine dependent endoprotease that plays a key role in the regulation of apoptosis (also referred as programmed cell death), an event which is known to be essential in growth and development of embryo, and maintenance of tissue homeostasis. Caspases are broadly classified as apoptosis or inflammation regulatory caspases based on their role in respective processes. Of those known, caspase - 3, -6, -7, -8 and -9 are categorized as apoptotic caspases, whereas caspase -1, -4, -5 and -12 are grouped as inflammatory caspases. The apoptotic caspases are further classified into initiator caspases (caspase -8 and -9) and effecter caspases (caspase -3, -6 and -7) based on their role in transducing the apoptotic signals emanating at the cell membrane.
Full Name
caspase 8, apoptosis-related cysteine peptidase
Research Areas
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • p53 Pathway
    p53 Pathway
  • TNF Signaling
    TNF Signaling
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Menon U, Raghuram P H, Kannan K, et al. Mutation Analysis of the Dimer Forming Domain of the Caspase 8 Gene in Oral Submucous Fibrosis and Squamous Cell Carcinomas[J]. Asian Pacific journal of cancer prevention: APJCP, 2014, 16(11): 4589-4592.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.