CALML3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

CALML3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
450 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens calmodulin-like 3.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CALML3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

CLP cDNA ORF Clone, Human

CALML3 Background Information

Calmodulin-like protein 3 (CALML3) is similar to that of authentic calmodulin and may actually compete with calmodulin by binding, with different affinity, to cellular substrates. Calmodulin-like protein 3 (CALML3) is a tumor-sensitive protein specifically expressed in normal epithelial cells but downregulated in tumorigenesis. Downregulation of the protein is an early event in breast cancer development. One of the most pressing questions raised by the discovery of CLP/CALML3 is that of its potential targets. Although it is 85% identical to human calmodulin, the distinct properties of CLP suggest that it has specific targets or targets that only partially overlap with those of calmodulin. Research has identified the unconventional myosin-1 (Myo1) as a specific target of CALML3. The discovery of Myo1 as a specific target of CALML3 is highly significant and suggests multiple lines of further research such as investigations of the Ca2+ regulation of Myo1 and the role of the loss of CLP in epithelial differentiation, adhesion, and cancer. Cells expressing CALML3 displayed a striking increase in the number and length of myosin-1-positive filopodia and showed increased mobility in a wound healing assay.
Full Name
calmodulin-like 3
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
References
  • Bennett RD, et al. (2007) Calmodulin-like protein increases filopodia-dependent cell motility via up-regulation of myosin-10. J Biol Chem. 282(5): 3205-12.
  • Perochon A, et al. (2011) Calmodulin and calmodulin-like proteins in plant calcium signaling. Biochimie. 93(12): 2048-53.
  • Chinpongpanich A, et al. (2011) Biophysical characterization of calmodulin and calmodulin-like proteins from rice, Oryza sativa L. Acta Biochim Biophys Sin (Shanghai). 43(11): 867-76.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.