CALB2 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

CALB2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
816 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human calbindin 2
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + XbaI(6.1kb+0.82kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CALB2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About CALB2

Entrez Gene ID

CALB2 cDNA ORF Clone, Human, untagged: Validated Images

CALB2 cDNA ORF Clone, Human, untagged: Synonyms

CAB29 cDNA ORF Clone, Human; CAL2 cDNA ORF Clone, Human; Calretinin cDNA ORF Clone, Human; CR cDNA ORF Clone, Human

CALB2 Background Information

Calretinin (CALB2) is a member of the EF-hand family of Ca(2+)-binding proteins and is expressed in a majority of poorly differentiated colon carcinoma and additionally in mesothelioma of the epithelioid and mixed type. Calretinin (CALB2) is a diagnostic marker for epithelioid mesothelioma. It is also a prognostic marker since patients with tumors expressing high calretinin levels have better overall survival. Silencing of calretinin decreases the viability of epithelioid mesothelioma cells. The calcium-binding protein calretinin (CALB2) is currently considered the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). Calretinin (CALB2) is a diagnostic and prognostic marker in malignant pleural mesothelioma (MPM).
References
  • Kresoja-Rakic J, et al. (2016) Identification of cis- and trans-acting elements regulating calretinin expression in mesothelioma cells. Oncotarget 7 (16): 21272-21286.
  • Häner K, et al. (2010) A bipartite butyrate-responsive element in the human calretinin (calb2) promoter acts as a repressor in colon carcinoma cells but not in mesothelioma cells. J Cell Biochem 109 (3): 519-531.
  • Blum W, et al. (2018) Regulation of calretinin in malignant mesothelioma is mediated by septin 7 binding to the calb2 promoter. BMC Cancer 18 (1): 475.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.