beta-Actin cDNA ORF Clone, Human, N-GFPSpark® tag

1/2
Price:
Size:
Number:

beta-Actin cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1128 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human actin, beta with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.86kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

beta-Actin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta-Actin cDNA ORF Clone, Human, N-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

beta-Actin cDNA ORF Clone, Human, N-GFPSpark® tag: Synonyms

BRWS1 cDNA ORF Clone, Human; PS1TP5BP1 cDNA ORF Clone, Human

beta-Actin Background Information

ACTB (Actin Beta) is a Protein Coding gene. Diseases associated with ACTB include Dystonia, Juvenile-Onset and Baraitser-Winter Syndrome 1. Among its related pathways are Salivary secretion and Development Slit-Robo signaling. Gene Ontology (GO) annotations related to this gene include identical protein binding and RNA polymerase II proximal promoter sequence-specific DNA binding. An important paralog of this gene is ACTG1. TUBB, HPRT and ACTB were the most stably expressed genes for all analysis groups across meningioma and non-pathological meningeal tissue combined. ACTB, a significant upregulated gene in abdominal aortic aneurysm samples, could be regulated by CLIC4, which was significantly enriched in cell motions. Dystonia-deafness syndrome is a well-known clinical entity, with sensorineural deafness typically manifesting earlier than dystonia. ACTB p.Arg183Trp heterozygosity has been reported in six patients to cause combined infant-onset deafness and dystonia manifesting in adolescence or young adulthood.
Full Name
actin, beta
  • Intracellular hydrogelation preserves fluid and functional cell membrane interfaces for biological interactions
    Author
    Lin, JC;Chien, CY;Lin, CL;Yao, BY;Chen, YI;Liu, YH;Fang, ZS;Chen, JY;Chen, WY;Lee, NN;Chen, HW;Hu, CJ;
    Year
    2019
    Journal
    Nat Commun
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.