BASP1 cDNA ORF Clone, Human, N-GFPSpark® tag

1/1
Price:
Size:
Number:

BASP1 cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 768T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human brain abundant, membrane attached signal protein 1 with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.41kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BASP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About BASP1

Entrez Gene ID

BASP1 cDNA ORF Clone, Human, N-GFPSpark® tag: Validated Images

BASP1 cDNA ORF Clone, Human, N-GFPSpark® tag: Synonyms

BASP1 cDNA ORF Clone, Human

BASP1 Background Information

The AML1-ETO fusion protein (A/E), which results from the t(8;21) translocation, is considered to be a leukemia-initiating event. Identifying the mechanisms underlying the oncogenic activity of A/E remains a major challenge. BASP1 silencing via promoter methylation may be involved in A/E-mediated leukemogenesis and that BASP1 targeting may be an actionable therapeutic strategy in t(8;21) AML. BASP1 is a novel prognostic factor for patients with cervical cancer, and promotes the proliferation and tumorigenicity of cervical cancer. BASP1 acts as a major selectivity factor in the transcriptional response of breast cancer cells to tamoxifen.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.