B Raf Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

B Raf Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2301 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens v-raf murine sarcoma viral oncogene homolog B1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

B Raf Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

B-RAF1 cDNA ORF Clone, Human; BRAF1 cDNA ORF Clone, Human; NS7 cDNA ORF Clone, Human; RAFB1 cDNA ORF Clone, Human

B Raf Background Information

BRAF gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. BRAFprotein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in BRAF gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in BRAF gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene.
Full Name
B-Raf proto-oncogene, serine/threonine kinase
Research Areas
Related Pathways
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
References
  • Weston-Bell NJ, Tapper W, Gibson J, et al. Exome Sequencing in Classic Hairy Cell Leukaemia Reveals Widespread Variation in Acquired Somatic Mutations between Individual Tumours Apart from the Signature BRAF V(600)E Lesion. Richards KL, ed. PLoS ONE. 2016;11(2):e0149162. doi:10.1371/journal.pone.0149162.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.