Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized)

Price:
Size:
Number:

Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized): General Information

Gene
Species
H9N2
RefSeq ORF Size
2274 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AGE15506.1.
Description
Full length Clone DNA of Influenza A virus polymerase Pb1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

polymerase basic 1 / PB1 cDNA ORF Clone, H9N2, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.