Guanarito mammarenavirus(S-56764) glycoprotein / GP Gene ORF cDNA clone expression plasmid

1/1
Price:
Size:
Number:

Guanarito mammarenavirus(S-56764) glycoprotein / GP Gene ORF cDNA clone expression plasmid: General Information

Gene
Species
GTOV
RefSeq ORF Size
1440 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAT72103.1.
Description
Full length Clone DNA of Guanarito mammarenavirus strain S-56764 glycoprotein / GP.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI(6.1kb+1.44kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' ) BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GTOV Glycoprotein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Guanarito mammarenavirus(S-56764) glycoprotein / GP Gene ORF cDNA clone expression plasmid: Validated Images

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.