Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) Matrix protein VP40 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag

Price:
Size:
Number:

Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) Matrix protein VP40 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag: General Information

Gene
Species
EBOV
NCBI Ref Seq
RefSeq ORF Size
981 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) Matrix protein VP40.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.