BMP4 cDNA ORF Clone, Canine, untagged

Price:
Size:
Number:

BMP4 cDNA ORF Clone, Canine, untagged: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1230 bp
Description
Full length Clone DNA of Canine bone morphogenetic protein 4.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BMP4 Background Information

BMP4 (bone morphogenetic protein-4)-directed differentiation of human embryonic stem cells (ESCd). Autophagy is a conserved catabolic process with complicated roles in tumor development. Bone morphogenetic protein 4 (BMP4), a member of the transforming growth factor (TGF-β) family of regulatory proteins, plays a crucial role in human malignancies. BMP4 treatment promoted HCC cells proliferation and induced autophagy. Mechanistic study revealed that the induction of autophagy by BMP4 was mediated through activating the JNK1/Bcl2 pathway. And the JNK1 inhibitor and knockdown of JNK1 could attenuate autophagy induced by BMP4 and eliminated BMP4-promoted HCC cells growth. BMP4 promoted HCC proliferation by autophagy activation through JNK1/Bcl-2 signaling.
Full Name
bone morphogenetic protein 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.