SARS-CoV-2 (2019-nCoV) Nucleoprotein Gene ORF cDNA clone expression plasmid, C-Myc tag (Codon Optimized)

COVID-19 Nucleocapsid Research.
1/1
Price:
Size:
Number:

SARS-CoV-2 (2019-nCoV) Nucleoprotein Gene ORF cDNA clone expression plasmid, C-Myc tag (Codon Optimized): General Information

Gene
Species
2019-nCoV
RefSeq ORF Size
1305 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with QHD43423.2 except for the point mutations: G335A.
Description
Full length Clone DNA of SARS-CoV-2 (2019-nCoV) Nucleoprotein / NP.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.67kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Coronavirus Nucleocapsid cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SARS-CoV-2 (2019-nCoV) Nucleoprotein Gene ORF cDNA clone expression plasmid, C-Myc tag (Codon Optimized): Validated Images

SARS-CoV-2 (2019-nCoV) Nucleoprotein Gene ORF cDNA clone expression plasmid, C-Myc tag (Codon Optimized): Synonyms

coronavirus NP cDNA ORF Clone, 2019-nCoV; coronavirus Nucleocapsid cDNA ORF Clone, 2019-nCoV; coronavirus Nucleoprotein cDNA ORF Clone, 2019-nCoV; cov np cDNA ORF Clone, 2019-nCoV; ncov NP cDNA ORF Clone, 2019-nCoV; NCP-CoV Nucleocapsid cDNA ORF Clone, 2019-nCoV; novel coronavirus NP cDNA ORF Clone, 2019-nCoV; novel coronavirus Nucleocapsid cDNA ORF Clone, 2019-nCoV; novel coronavirus Nucleoprotein cDNA ORF Clone, 2019-nCoV; np cDNA ORF Clone, 2019-nCoV; nucleocapsid cDNA ORF Clone, 2019-nCoV; Nucleoprotein cDNA ORF Clone, 2019-nCoV

Coronavirus Nucleocapsid Background Information

Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus nucleoproteins localize to the cytoplasm and the nucleolus, a subnuclear structure, in both virus-infected primary cells and in cells transfected with plasmids that express N protein. Coronavirus N protein is required for coronavirus RNA synthesis, and has RNA chaperone activity that may be involved in template switch. Nucleocapsid protein is a most abundant protein of coronavirus. During virion assembly, N protein binds to viral RNA and leads to formation of the helical nucleocapsid. Nucleocapsid protein is a highly immunogenic phosphoprotein also implicated in viral genome replication and in modulating cell signaling pathways. Because of the conservation of N protein sequence and its strong immunogenicity, the N protein of coronavirus is chosen as a diagnostic tool.
References
    1. 1.Van Boheemen S, et al. (2012), MBio. 3(6):e00473-12.
    2. Bisht H. et al., 2004, Proc Natl Acad Sci. 101 (17): 6641-6.
    3. Li W. et al., 2005, Science. 309 (5742): 1864-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.