CCT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

CCT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1638 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens chaperonin containing TCP1, subunit 3 (gamma).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CCT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

CCT-gamma cDNA ORF Clone, Human; CCTG cDNA ORF Clone, Human; PIG48 cDNA ORF Clone, Human; TCP-1-gamma cDNA ORF Clone, Human; TRIC5 cDNA ORF Clone, Human

CCT3 Background Information

Full Name
chaperonin containing TCP1, subunit 3 (gamma)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait