Lentiviral Vector pLV-C-GFPSpark®
pLV-C-GFPSpark® Physical Map
Schematic of pLV-C-GFPSpark® Multiple Cloning Sites
Cloning Sites for ORF Inserting
Lentiviral Vector pLV-C-GFPSpark® Information Description
| Vector Name | pLV-C-GFPSpark® |
| Vector Size | 7395bp |
| Vector Type | Lentiviral Vector |
| Promoter | Enhancer CMV |
| Antibiotic Resistance | Ampicillin |
| Protein Tag | GFPSpark® |
| Sequencing Primer | F: pLen-F(CTCGTTTAGTGAACCGTCAGAATT) |
| R: pLen-R(GAACCGGAACCCTTAAACATGT) |
GFPSpark® Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
