pCMV3-N-GFPSpark® Vector

pCMV3-N-GFPSpark® Physical Map

pCMV3-N-GFPSpark® Physical Map Comments for pCMV3-N-GFPSpark®:
• CMV promoter: bases 250-837
• Enhancer: bases 838-1385
• SV40 early promoter: bases 3969-3338
• Hygromycin ORF: bases 3356-4381
• pUC origin: bases 5024-5697
• Kanamycin ORF: bases 5771-6586

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-N-GFPSpark® Information Description

Vector Name pCMV3-N-GFPSpark®
Vector Size 6728bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag GFPSpark®
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

GFPSpark® Tag Information

GFPSpark® is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark® is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.