![]() |
Comments for pCMV3-C-OFPSpark®: |
• CMV promoter: bases 250-837 • Enhancer: bases 838-1385 • SV40 early promoter: bases 2987-3356 • Hygromycin ORF: bases 3374-4399 • pUC origin: bases 5042-5715 • Kanamycin ORF: bases 5789-6604 |
Vector Name | pCMV3-C-OFPSpark® |
Vector Size | 6746bp |
Vector Type | Mammalian Expression Vector |
Expression Method | Constitutive, Stable / Transient |
Promoter | CMV |
Antibiotic Resistance | Kanamycin |
Selection In Mammalian Cells | Hygromycin |
Protein Tag | OFPSpark®(GATAGCACTGAG……CACCTGTTCCAG) |
Sequencing Primer | Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG) |
OFPSpark® is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark® is more than twice brighter than mOrange2. Fast OFPSpark® maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection.
OFPSpark® can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark® expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark® performs well in some fusions and protein labeling applications.
Call Us On
215-583-7898For Product Information and Orders
For Business Collaboration
bd@sinobiological.comFor CRO Services
cro_us@sinobiological.comFor Technical Support
support_us@sinobiological.comFollow Us On