![]() |
Comments for pCMV3-C-Myc: |
• CMV promoter: bases 250-837 • Enhancer: bases 838-1385 • SV40 early promoter: bases 2345-2714 • Hygromycin ORF: bases 2732-3757 • pUC origin: bases 4400-5073 • Kanamycin ORF: bases 5147-5962 |
Vector Name | pCMV3-C-Myc |
Vector Size | 6104bp |
Vector Type | Mammalian Expression Vector |
Expression Method | Constitutive, Stable / Transient |
Promoter | CMV |
Antibiotic Resistance | Kanamycin |
Selection In Mammalian Cells | Hygromycin |
Protein Tag | Myc(GAGCAGAAACTCATCTCAGAAGAGGATCTG) |
Sequencing Primer | Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG) |
A Myc tag is a polypeptide protein tag derived from the c-Myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.
A Myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a Myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.
The peptide sequence of the Myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.
Call Us On
215-583-7898For Product Information and Orders
For Business Collaboration
bd@sinobiological.comFor CRO Services
cro-service@sinobiological.comFor Technical Support
support_us@sinobiological.comFollow Us On