![]() |
Comments for pCMV3-C-FLAG: |
• CMV promoter: bases 250-837 • Enhancer: bases 838-1385 • SV40 early promoter: bases 2339-2708 • Hygromycin ORF: bases 2726-3751 • pUC origin: bases 4394-5067 • Kanamycin ORF: bases 5141-5956 |
Vector Name | pCMV3-C-FLAG |
Vector Size | 6098bp |
Vector Type | Mammalian Expression Vector |
Expression Method | Constitutive, Stable / Transient |
Promoter | CMV |
Antibiotic Resistance | Kanamycin |
Selection In Mammalian Cells | Hygromycin |
Protein Tag | FLAG(GATTACAAGGATGACGACGATAAG) |
Sequencing Primer | Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG) |
FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.
A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.
The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.