TSPAN8 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

TSPAN8 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
714 bp
Description
Full length Clone DNA of Human tetraspanin 8
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TSPAN8 cDNA ORF Clone, Human, untagged: Alternative Names

CO-029 cDNA ORF Clone, Human; TM4SF3 cDNA ORF Clone, Human

TSPAN8 Background Information

Tetraspanin 8 (TSPAN8) as an important modulator of melanoma invasiveness, and several of its transcriptional regulators, which affect TSPAN8 expression during melanoma progression toward an invasive stage. p53 as a negative regulator of Tspan8 expression. p53 as a regulator of melanoma invasion and the concept that reactivating p53 could provide a strategy for modulating not only proliferative but also invasive capacity in melanoma treatment. Tetraspanin 8 (TSPAN8) is a tumor-associated antigen implicated in tumor progression and metastasis. TSPAN8 may play an important role in mCRC cell invasion. TSPAN8 was overexpressed in human gastric cancer tissues and gastric cancer cell lines compared with the normal. TSPAN8 overexpression promoted cell proliferation and invasion, while TSPAN8 suppression inhibited cell proliferation and invasion. TSPAN8 could activate the ERK MAPK pathway in gastric cancer cells, and MEK-ERK inhibition reversed the effects of TSPAN8 overexpression on cell proliferation and invasion.
Full Name
tetraspanin 8
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait