Secretogranin 3 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Secretogranin 3 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Human secretogranin III
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Secretogranin 3 cDNA ORF Clone, Human, untagged: Alternative Names

SGIII cDNA ORF Clone, Human; UNQ2502/PRO5990 cDNA ORF Clone, Human

Secretogranin 3 Background Information

SCG3, also known as secretogranin 3, is a member of the chromogranin/secretogranin family. Members of this family may serve as precursors for biologically active peptides. SCG3 is transported to secretory granules (SGs) in neuroendocrine cells. SCG3 binds strongly to chromogranin A (CgA) in an intragranular milieu and targets CgA to SGs in pituitary and pancreatic endocrine cells. With a sucrose density gradient of rat insulinoma-derived INS-1 cell homogenates, SgIII is localized to the SG fraction and is fractionated to the SG membrane (SGM) despite lacking the transmembrane region.
Full Name
secretogranin III
References
    >
  • Rong YP. et al., 2002, Sheng Wu Wu Li Xue Bao. 34 (4): 411-7.
  • Huttner WB. et al., 1991, Trends Biochem Sci. 16 (1): 27-30.
  • Ozawa H. et al., 1996, Cell Struct Funct. 20 (6): 415-20.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait