Thrombopoietin cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

Thrombopoietin cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
981 bp
Description
Full length Clone DNA of Rat thrombopoietin with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Thrombopoietin Background Information

Thrombopoietin (TPO or THPO), also known as myeloproliferative leukemia virus ligand (c-Mpl), is a hematopoietic growth factor belonging to the EPO/TPO family. The thrombopoietin protein is produced mainly by the liver and the kidney that regulates the production of platelets by the bone marrow. Thrombopoietin protein stimulates both proliferation of progenitor megakaryocytes and their maturation to platelet-producing megakaryocytes, and also accelerates the recovery of platelets. Thrombopoietin protein is involved in cardiovascular disease as it regulates megakaryocyte development and enhances platelet adhesion/aggregation. It has been identified that surface c-MPL, the receptor for thrombopoietin protein, binds to the ligand and mediates the action.
Full Name
thrombopoietin
References
  • Ryu T,et al.(2003) Thrombopoietin-producing hepatocellular carcinoma. Intern Med. 42(8): 730-4.
  • Higashihara M,et al. (2003) Thrombopoietin-producing tumor. Intern Med. 42(8): 632-3?
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait